You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
A sequence file in IG format can contain several sequences, each consisting of a number of comment lines that must begin with a semicolon (";"), a line with the sequence name (it may not contain spaces) and the sequence itself terminated with the termination character '1' for linear or '2' for circular sequences.
Here is an example for the sequence named "AB000263" with linear characteristic:
; this is a comment.
AB000263
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA1
The text was updated successfully, but these errors were encountered:
A sequence file in IG format can contain several sequences, each consisting of a number of comment lines that must begin with a semicolon (";"), a line with the sequence name (it may not contain spaces) and the sequence itself terminated with the termination character '1' for linear or '2' for circular sequences.
Here is an example for the sequence named "AB000263" with linear characteristic:
The text was updated successfully, but these errors were encountered: