fastq processing error

[grokkaine]

I have two batches of fastq files, the older one gets processed by Crass but the newer one throws this error.

[ERROR]: Header: HWI-D00456:77:C70WLANXX:1:1101:10963:2182
LowLexi: 112
0,21,62,84,104,126,
Sequence:CACCATGGAAGACCTTCCTAACACCATGGTAGACATTCCTTACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTTCTAA

Len: 126

---

ss list out of range; 126 > 125
ReadHolder.cpp : 924 : bool ReadHolder::getNextSpacer(std::string_)
[ERROR]:
ReadHolder.cpp : 235 : void ReadHolder::getAllSpacerStrings(std::vectorstd::basic_string&)
[ERROR]: Fatal error in search algorithm!
libcrispr.cpp : 146 : int searchFile(const char_, const options&, ReadMap_, StringCheck_, lookupTable&, lookupTable&, time_t&)
[ERROR]: FATAL ERROR: parseSeqFiles failed
WorkHorse.cpp : 191 : int WorkHorse::doWork(Vecstr)

The fastq files check out right with fastQValidator. They were used for a metagenomic assembly before, so I don't expect them to be faulty (still you never know). I will try to cut out a complete FASTQ record and attach it to the issue.

What is this 125, my length here is 126?

[ctSkennerton]

I think I've fixed this bug. try downloading version 1.0.1 and see if it works.